facebook
twitter

Вие сте тук

82 постове / 0 нови
Последно съобщение

Страници

Талибан

На въпроса с въпрос: A кое е доказателството, че ежедневните случаи в Малайзия са непременно SARS-CoV-причинени.

Ти НЯКАКВО доказателство приложи ли към твърденията си? Или само аз трябва да доказвам, а ти не? Навъдили са се едни селски тарикати, не е за разправяне...

Стоф

 Много им се иска на някои лица и мафии провала на ЕС, защото никак не им оттърва правовата система. 

Стоф

При това ще речеш, че останалата част от света не е в криза. 

 

Ференги

Я ни напомни кой първи въведе социалната самоизолация - Баце или твоят Жужо?

Той верно, че спря полетите за репатриация в РФ и изкомандва всеобща ваканция...

Но от друга страна тренировките за парада на 9 май все още не са прекратени.

Планирано е участието на близо 15000 военнослужещи на РФ, съответното количество жива сила е вече предислоцирана доколкото разбрах от средата на март.

И не, няма грешка в нулите.

HBK

Ти НЯКАКВО доказателство приложи ли към твърденията си? Или само аз трябва да доказвам, а ти не? Навъдили са се едни селски тарикати, не е за разправяне...

 

Тали(Ба)бан,

 

 Нека най-напред нека да уточним доказателства за кои мои твърдения желаете:

 

1. Заболяването COVID-19, причинено от вируса  SARS-CoV-2, е вид Остра Респираторна Вирусна Инфекция (ОРВИ).

 

2. ОРВИ се появяват най-често под формата на сезонни епидемии/пандемии.

 

И още нещо: Ще бъде ли удовлетворен изтънчения талибански вкус от твърдения/доказателства предоставени от организации като Световната Здравна Организация и Европейския Център за Контрол и Превенция на Заболяванията? Или ще трябва да се аклиматизираме до нивото на „едни селски тарикати ... „ абе „не е за разправяне”.

 

P.S. Ако не разбирате от езици можете да помолете за превод. Включително и на цитираните от мен по-горе пасажи.

Талибан

Няма кво да уточняваме бе, "пич". Аз съм те репликирал, а ти вместо да ми отговориш си ми задал въпрос.

 

Ше ти го повторя. За твое съжаление, отново на български, който очевидно си позабравил:

 

Мда, поредното изхвърляне на "експерта". Ми ти нямаш достатъчно данни, за да твърдиш подобно нещо. Отново ще кажа, че в Малайзия температурите всеки ден надхвърлят 35 градуса, което не пречи всеки ден да има нови случаи. Кое е сезонното тук? 

Това е в отговор на твърдението ти, че: 

 

"Настоящата епидемия е една от многото остри респираторни вирусни инфекции (сезонни) случвали се през годините; нито по-тежка, нито по лека."

 

Ей тва ми докажи, дето си написал тъй уверено. Докажи ми, че настоящата епидемия е една от многото остри респираторни вирусни инфекции (сезонни) случвали се през годините; нито по-тежка, нито по лека.

 

При положение, че още сме в разгара на епидемията, и при положение че това е първи сблъсък на човечеството с тоя вирус, аз съвсем отговорно заявявам, че просто се правиш на интересен. Няма как да докажеш недоказуемото. Това нещо може да бъде доказано чак след като цялата патаклама отмине и погледнем от дистанция.

 

Селски тарикати не, ами направо уонаби оракули.

ловkия

Губиш си времето.

Фактите отскачат далеч от чугуна.

Lola the Kinks

“ДОБРЕ ДОШЛИ В НОВИЯ СВЕТОВЕН РЕД! /ВИДЕО/”

Гаргарон Гаргамелски

https://www.facebook.com/100032006418638/videos/22...

HBK

HBK,

  а секса в коя точка ще го вметнеш?

 

Хареса ми! Предполагах, че той е притурка към Спа-центровете. Изпуснах го защото предполагах, че се саморазбира. Както и „илачите”, които съм изброил могат да се считат за притурка към секса. В зависимост от възрастта и потенциите – причинно-следствените взаимоотношения могат да се преобърнат.

Lola the Kinks

И не забравай, че Глашатаят на Смъртта забрани "шведските тройки"!

ppipi7766

ЕС се провали, не може да го водят посредствени ръководители, критикува президентът на Чехия

 

Това ше промени много повече животи от вируса.

Тежко на живите!

Талибан

Ще добавя още нещо към горния си коментар:

 

Mystery Protein · ORF8

 

The gene for this accessory protein is dramatically different in SARS-CoV-2 than in other coronaviruses. Researchers are debating what it does.

 

augaaauuucuuguuuucuuaggaaucaucacaacuguagcugcauuucaccaagaauguaguuuacag

ucauguacucaacaucaaccauauguaguugaugacccguguccuauucacuucuauucuaaaugguau

auuagaguaggagcuagaaaaucagcaccuuuaauugaauugugcguggaugaggcugguucuaaauca

cccauucaguacaucgauaucgguaauuauacaguuuccuguuuaccuuuuacaauuaauugccaggaa

ccuaaauuggguagucuuguagugcguuguucguucuaugaagacuuuuuagaguaucaugacguucgu

guuguuuuagauuucaucuaaacgaacaaacuaaa

 

https://www.nytimes.com/interactive/2020/04/03/sci...

 

Тъй като НВК е напред с материала, може би той ще ни разясни кво прави този протеин. Нали, НВК?

 

Bacho Кольо

Някой знае ли   котарака/Спас/imdi под какво име се подвизава сега?

Много ми прилича на един изфъляч тука.

kaily
снимка на kaily

Във Франция през първото тримесечие на 2017 г от грип са починали 24 000 души.

In addition, a 9-week long particularly harsh flu epidemic had a decimating effect on people aged 65 and over during the first three months of the year. The INSEE says it caused 24,000 extra deaths.

https://www.euronews.com/2016/02/15/flu-and-weathe...

paragraph39

САЩ са конфискували карго с медицински маски от Китай, предназначени за германската полиция

05.04.2020

http://www.focus-news.net/news/2020/04/05/2763463/...

paragraph39

👀

VAERINGJAR

Европа е пред най-тежката криза от Втората световна война насам

Ми то това е и целта с голямото "Ц" на активното мероприятие с кодовото название "ЦОВИД-19" провеждано в момента. А от кого? Ами кой фалира два пъти през миналия век и си оправи дереджето с две световни войни, и сега фалира за трети път? Обаче достатъчно убедително му беше намекнато, че вече с нова гореща война няма да стане щото си "заминава" и той. И зтова са тия изпълнения - да се нанесат на световната икономика поражения като след Световна война, само че без война. За да "клекнат" ПАК всички както след първите две Войни пред портите на ФЕД за план "Маршал"...

HBK

Талибан,

Наистина ли желаете да Ви засипя със данни за много по-тежко протичащи епидемии/пандемии от остри респираторно вирусни инфекции през столетията. Включително и от други модификации на същия вирус.

 

Mystery Protein · ORF8

 

Тъй като НВК е напред с материала, може би той ще ни разясни кво прави този протеин. Нали, НВК?

 

Нека най-напред да отбележа, че  нито имам познания, нито имам претенции за такива в Молекулярната Биология. Но още от изпитите, които съм полагал си спомням, че първичните резервоари за SARSr-CoVs са прилепите. Въпросът бе по какъв начин вирусните нуклеотиди от прилепите са били трансмисирани на хора. Роля в тази трансмисия играе именно ORF8 нукеотидната поредица. Ако въпроса ти е че между вирусите съществуват различия – не си заслужава да говоря. Различия има даже между два косъма от собствената ви глава.

За повече подробности в Молекулярната Биология очаквам уважаемият талибан да допълни.

vasilevil

БАРЕКОВ короната се лекува с 50 лева

 

https://bgnews.space/2020/04/04/%d0%bd%d0%b8%d0%ba...

fractal
снимка на fractal

Бледоликите правеха аборти хапчета антибебе презервативи маструбации  дойде епидемия

Няма млади попълнения

Талибан

US Surgeon General on coronavirus: Next week will be our Pearl Harbor moment

 

https://www.youtube.com/watch?v=1qdoa_V19zQ

Страници

×